WormBase Tree Display for Variation: WBVar00142924
expand all nodes | collapse all nodes | view schema
WBVar00142924 | Evidence | Paper_evidence | WBPaper00025184 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e30 | |||||||
Other_name (12) | |||||||||
HGVSg | CHROMOSOME_V:g.11908351G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R31 | |||||
Flanking_sequences | caagaagcaggaagcactcagaaccgcatg | aacacactgtgtgaatacatcgaagcacgt | |||||||
Mapping_target | R31 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00025184 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (14) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004855 | |||||||
Transcript | R31.1e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1e.1:c.5889G>A | ||||||||
HGVSp | CE52987:p.Trp1963Ter | ||||||||
cDNA_position | 5889 | ||||||||
CDS_position | 5889 | ||||||||
Protein_position | 1963 | ||||||||
Exon_number | 8/17 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1a.1:c.5889G>A | ||||||||
HGVSp | CE41581:p.Trp1963Ter | ||||||||
cDNA_position | 6004 | ||||||||
CDS_position | 5889 | ||||||||
Protein_position | 1963 | ||||||||
Exon_number | 9/20 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1c.1:c.5331G>A | ||||||||
HGVSp | CE46009:p.Trp1777Ter | ||||||||
cDNA_position | 5331 | ||||||||
CDS_position | 5331 | ||||||||
Protein_position | 1777 | ||||||||
Exon_number | 5/15 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1b.1:c.5580G>A | ||||||||
HGVSp | CE27773:p.Trp1860Ter | ||||||||
cDNA_position | 5580 | ||||||||
CDS_position | 5580 | ||||||||
Protein_position | 1860 | ||||||||
Exon_number | 7/17 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1d.1:c.5580G>A | ||||||||
HGVSp | CE46252:p.Trp1860Ter | ||||||||
cDNA_position | 5822 | ||||||||
CDS_position | 5580 | ||||||||
Protein_position | 1860 | ||||||||
Exon_number | 8/18 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1f.1:c.5331G>A | ||||||||
HGVSp | CE53064:p.Trp1777Ter | ||||||||
cDNA_position | 5331 | ||||||||
CDS_position | 5331 | ||||||||
Protein_position | 1777 | ||||||||
Exon_number | 5/14 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000500863 | ||||||||
Genetics | Interpolated_map_position | V | 3.53978 | ||||||
Mapping_data | In_2_point (12) | ||||||||
In_multi_point (74) | |||||||||
In_pos_neg_data | 296 | ||||||||
852 | |||||||||
867 | |||||||||
1742 | |||||||||
1754 | |||||||||
1815 | |||||||||
2130 | |||||||||
3408 | |||||||||
6770 | |||||||||
6869 | |||||||||
Description | Phenotype | WBPhenotype:0000071 | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | larvae have shortened, round heads | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00000031 | |||||||
WBPaper00038069 | |||||||||
WBPaper00003094 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPerson415 | |||||||||
Remark | Double mutants of show additive effects. | Paper_evidence | WBPaper00038069 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000322 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | round-headed, especially in early larvae | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000324 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | short, especially in early larvae | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00061063 | |||||||
Curator_confirmed | WBPerson172 | ||||||||
Remark | Fig 2B | Paper_evidence | WBPaper00061063 | ||||||
Curator_confirmed | WBPerson172 | ||||||||
WBPhenotype:0000645 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | adults have slight rolling tendency | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | animals exhibited the same defects observed in iv38 homozygotes | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005788 | PATO:0000460 | Paper_evidence | WBPaper00040002 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00040002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (15) | |||||||||
Method | Substitution_allele |