WormBase Tree Display for RNAi: WBRNAi00085280
expand all nodes | collapse all nodes | view schema
| WBRNAi00085280 | Homol | Homol_homol | K04D7:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggtccaagagcaaatgaagcttaccggaaccctcgagggtcacaccggatgggttacccaaatcgccacctacacccgcaacgacaagaccactgtcctgtcatcttcccgcgacaagactatccttgtttgggatgtcgacagcgttgctccagtcgatgagggaccaatcggtcgcccagttcgttcgctcactggacataaccacttcgtctctgacgttgtcatctcctccgacggacaattcgctctttctggatcctgggacaagaccctccgcctctgggacctcaaccagggagtgagcacccgtcaattcatctcccacaccaaggatgttctctctgttgccttctctgctgacaacagacaaatcgtctctggatcccgcgacaagtccatcaagctgtggaacactcttgcccagtgcaagtacaccatcactgatgattgccacaccgattgggtttccaccgttcgtttctctccatcgaaccgcgatccagtgatcgtctccgcaggatgggacaaggttgtcaaggtctggaacctcggaaactgccgtctgaagaccaaccacatcggtcacaccggatacgtcaacaccgttaccgtctctccagatggttccctctgtgcttccggaggcaaagacggacaagctatgctttgggacctcaacgagggcaagcacttgtacacccttccaggaaacgacgtcatcaacgccatgtccttctctccaaacagatactggctctgcgccgctgtcggatcttccatcaagatctgggatctcgaggacaagaaggagatcgaggagctcaagccagaaatcgccagctctggaagctcaagaggatccagcccacagtgtatctctttggcctggtctcaagacggacaaaccctcttcgccggatacaccgataacatcatccgagtgtaccaggtgtcgatccgtgcttccaactaa | |||
| Experiment | Laboratory | LE | |||
| Date | 21 Oct 2010 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | K04D7.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00010556 | Inferred_automatically | RNAi_primary | ||
| Transcript | K04D7.1.1 | Inferred_automatically | RNAi_primary | ||
| K04D7.1.3 | Inferred_automatically | RNAi_primary | |||
| K04D7.1.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00037834 | ||||
| Phenotype | WBPhenotype:0000384 | Remark | rack-1(RNAi) disrupted the proper pathfinding of the VD and DD commissural axons. Specific defects include - axon misguidance, branching and premature termination. | ||
| Penetrance | Range | 22 | |||
| WBPhenotype:0000633 | |||||
| WBPhenotype:0001224 | Remark | Defects include axon misguidance and premature termination. | |||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation (K04D7.1.1). | ||||
| Method | RNAi |
