WormBase Tree Display for RNAi: WBRNAi00086896
expand all nodes | collapse all nodes | view schema
| WBRNAi00086896 | Homol | Homol_homol | F32E10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | accaacatcctcatagacaccgtttgggccctttcttacctcaccgacggtggaaatgaacacattcaaatggttatcgaagctcaagttgttacccatctcgttccactccttggacacgttgatgttaaagttcaaacagcagcacttcgagctgtaggaaatattgtgactggaaccgacgaacaaacacaacttgtgttggatagcggagttcttcggtttatgccaggacttctcgcccactacaaagagaaaataaacaaagaggctgtttggtttgtctccaacataactgctggaaaccaacaacaagttcaagacgtattcgacgccggaatcatgccaatgattattcatcttcttgatcgaggagatttcccaactcaaaaagaggcagcgtgggctatttccaacgttacaatctctggccgtccaaatcaagttgagcaaatggtaaagcttggtgtccttcgtcctttctgtgcgatgctcagttgcactgattcgcagattatccaagtagtgcttgatggaattaacaacattctgaaaatggctggagaagctgccgaacaggtgacatcagagattgaagagtgcggaggtcttgacaagatagaaaatcttcaaaatcatgaaaacgaggacatttacaaactggctttcgaaattatcgataacttcttcagttccgatgatgagactggcaacgtggaaggagctcaaagttctgcttttggaggcgacgttccaccagttcctgatgctccaaacggaggatggaactttggaaag | |||
| Experiment | Date | 01 Dec 2002 00:00:00 | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F32E10.4 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00002074 | Inferred_automatically | RNAi_primary | ||
| Transcript | F32E10.4.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005637 | ||||
| Phenotype | WBPhenotype:0000062 | ||||
| WBPhenotype:0000154 | Remark | 91 to 100% of the embryos failed to hatch. ima-3(RNAi) embryos were significantly reduced in size. However, spindle formation seemed relative normal as judged from the presence of a metaphase plate and DIC images. Nuclei were formed in ima-3(RNAi) embryos upon cell division and grew to nearly normal size, illustrating that IMA-3 is not required for nuclear formation in early embryos. | |||
| WBPhenotype:0001792 | |||||
| Phenotype_not_observed | WBPhenotype:0000759 | ||||
| Remark | ima-3, nt 745 to 1542 of predicted ORF was used for RNAi. Only intron-less sequences were amplified. | ||||
| Method | RNAi |
