MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression during animal development. Large scale efforts to identify functions of individual miRNAs or miRNA families provide invaluable insight into the roles these miRNAs play in organism development (Miska et al. 2007, Alvarez-Saavedra and Horvitz 2010), however, some miRNA genes lack deletion alleles. To our knowledge, no alleles in C. elegans
mir-1022 gene are currently available.Using CRISPR/Cas9 genome editing technique, we generated two novel alleles in the
mir-1022 locus in C. elegans (Fig 1A). The
zen97 allele is a 498 pair deletion of the
mir-1022 locus which also inserts GAGGGGATT into that locus (Fig 1B). The
zen98 allele is a 508 base pair deletion from the
mir-1022 locus, inserting CGGTGTACAATGTATACAATGT in that location (Fig 1B). To specifically target the
mir-1022 locus for editing, we used the following guide RNAs: mir-1022_gRNA 1: 5-TCGGGCCAACACATTTCAG-3′ and mir-1022_gRNA 2: 5-TTTGCGTGCGAAAGTGGTGA-3′. The primers used for PCR genotyping were
mir-1022.
for3: 5-CTAGTGCATTGTCCAGGCAG-3′ and
mir-1022.
rev3: 5-CGTGATCTCTTGGTGCACAT-3. The Co-CRISPR marker
dpy-10 was used in order to more easily identify worms with active CRISPR/Cas9 as previously described (Arribere et al. 2014). CRISPR components were injected into N2 animals as an RNP complex (Paix et al. 2015). Alt-R Cas9 (cat# 1081058),
mir-1022 and
dpy-10 Alt-R CRISPR-Cas9 crRNAs (custom), and tracer RNA (cat# 1072532) were purchased from IDT. PCR screening identified two independent mutations, each disrupting the
mir-1022 locus (Fig 1), which were subsequently homozygosed and sequenced. UY262
mir-1022(
zen97) did not segregate any dumpy, dumpy roller, or roller animals and was not outcrossed.
mir-1022(
zen98) was outcrossed once to wild type (N2) males to remove a background
dpy-10 mutation, generating the 1x outcrossed UY286
mir-1022(
zen98) strain. Sequencing was repeated to confirm the mutation.Both alleles are homozygous viable. While not extensively characterized, no gross morphological phenotype was produced by either
mir-1022 allele. Further phenotypic analysis will be necessary to determine the exact effect of the two
mir-1022 mutations.