We report
tm6429 and
tm6475 as novel deletion alleles of the gene Y73E7A.1 that is a homologue of mammalian Coiled-coil domain containing 124 (Ccdc124)1. The Ccdc124 is a conserved gene from invertebrates to human. In human cell lines, Ccdc124 is a component of the centrosome during interphase and at the G2/M transition. During cell division, Ccdc124 relocates to the midbody at telophase and acts as an essential molecular component in cytokinesis2. The alleles were isolated from the comprehensive screening of gene deletions generated by TMP/UV3. In the screening, both the alleles were detected by nested PCR using the following primer sets, 5'-GTGTGAATCGAGGAGGCGCA-3' and 5'-TTTCCAGTCCGGCAGGCGAT-3' for first round PCR and 5'- AACGGCAAACGCGCTCTATG-3' and 5'- CGTGTGCACGTGGAAGTCCA-3' for second round PCR. By Sanger sequencing, the 30bp flanking sequences of the alleles
tm6429 and
tm6475 were identified as TTTTAAATCGATTTTTGAGCACCAAAATTA- [355 bp deletion + 1 bp insertion (T)] - TTAAAAATGAGAAAAAATGGGGAAAAAATT and CAAACGCGCTCTATGGAGAATGTGGAATTA- [242 bp deletion] - TTTTATATAGGATTTTAATTTTCAGGCCAC, respectively. Based on the information about the splicing isoforms of Y73E7A.1 (WormBase,
http://www.wormbase.org, WS259), the start codon of Y73E7A.1a and Y73E7A.1b transcripts are deleted in
tm6429 and
tm6475, respectively (Fig. 1), suggesting that those alleles may be usable for the analysis of isoform specific function.