The immunoglobulin superfamily member
sax-7 produces a long and short isoform that appear to have distinct functions (Chen et al. 2001; Wang et al. 2005; Sasakura et al. 2005; Pocock et al. 2008). An isoform-specific allele for the long isoform,
sax-7L, was previously reported (Sasakura et al. 2005), but an isoform-specific allele for the short isoform,
sax-7S, has been lacking (Fig. 1A). We used CRISPR/Cas9 to generate such an allele, using the
unc-22 co-CRISPR method (Kim et al. 2014). The
ot820 allele was isolated using sgRNA targeted to the first exon of
sax-7S (sgRNA sequece: 5 - TGGGGTTACGAGAGACGAT - 3). Twitching progeny were screened by PCR and Sanger sequencing, and an 8bp deletion 15bp from the start codon was isolated (screening primers: 5 - GGTGCTTCTCTGGTGGTAGC - 3 and 5 - TGTTGGCAAACAAAATACACG - 3, Fig. 1B). While the
sax-7L isoform is predicted to be entirely unaffected by this allele, the resultant frameshift is predicted to generate a 49 amino acid protein in which all but the first five amino acids of
sax-7S are aberrant and has no predicted signal sequence, before terminating in a premature stop in the second exon (Fig. 1B). This allele therefore likely represents a null for the
sax-7S isoform. After we generated this allele, a recent paper reported an additional
sax-7S-specific allele, with somewhat similar, but not identical sequence properties (Chen et al., 2019). Consistent with previous evidence of distinct functions of
sax-7 isoforms, these authors showed differing axon fasciculation defects between these two alleles, which is further distinct from a total null allele. These new
sax-7S alleles should help to reveal new insights into the role of L1CAM/SAX-7 isoforms in the nervous system.