pDYH39

A single genomic fragment covering both genes (containing the coding sequences, 3'-UTRs, and the shared promoter region) was inserted into an empty vector pMD19T by T-A ligation.

pOK255.04

The proximal T-box site was mutated in the Ptbx-2::gfp plasmid pOK206.33 (AGGTGGCA to ATTGTGC) using the Stratagene QuikChange II kit to produce Ptbx-2prox::gfp plasmid pOK255.04.

pMR701

From T01C8, authors sub-cloned an 11.1 kb fragment (NcoI/PstI) containing aak-2 into pGEM-T and injected it (10 nanograms per microliter) into daf-2; rr48 hermaphrodites, rescuing the dauer lethality phenotype.

pIN05

Clone = pIN05. This construct was made by cloning the whole genomic fragment of daf-18 starting 1.3 kb upstream of the ATG and ending 0.5 kb downstream of the STOP and cloning to pGEM-T.

pSP040

The rescuing construct containing cav-2 driven by its own promoter (pSP040) consisted of a genomic DNA fragment amplified using the upstream and downstream oligonucleotides SP650 and SP653, and cloned into pGEM-T (Promega, Southampton, UK).

pOK278.02

A 42 bp fragment (-1157 to -1116 upstream of the tbx-2 ATG) containing the pair of distal T-box sites were deleted by inverse PCR of pOK206.33 with primers PO1256 [GACTCTAGAAGTGATAAGAAGCCGCGAG], digested with XbaI, and recircularized by ligation, to produce Ptbx-2dist::gfp plasmid pOK278.02 .

pIN03

Clone = pIN03. This mutated daf-18 construct was made by fusion PCR of two overlapping fragments of the whole genomic daf-18 starting 1.3 kb upstream of the ATG and ending 0.5 kb downstream of the STOP using primers which contain the mutation G174E (GGC to GAA) in the overlapping region and cloning to pGEM-T.

pOK185.01

Derived from OK0469 [cuEx363] following EMS mutagenesis. The ceh-22::gfp fusion pOK185.01 (kindly provided by T. Vilimas) contains an SphI to XhoI ceh-22 promoter fragment (bp 14719 to 17467 of F29F11, accession Z73974) (Kuchenthal et al., 2001) fused to a gfp::his2B orf derived from SEM474 (Gaudet and Mango, 2002) to promote tight nuclear localization of GFP.

pCR2

The vit-2::GFP reporter pCR2 was made by inserting a 366 bp XbaI/SacI(filled) fragment containing the 247 bp minimal vit-2 promoter from pFPO-gfp-V3'(FUB1) (gift of M. MacMorris and T. Blumenthal) into XbaI/SmaI cut pPD95.70 (gift of A. Fire). The resulting plasmid has the minimal 247 bp vit-2 promoter followed by the first 14 amino acids of vit-2, a synthetic intron and the GFP coding sequence.

pRB490

From paper WBPaper00005147/PMID:11867711: "The DAT-1 transcriptional green fluorescent protein (GFP) fusion (Pdat-1::GFP) was created by PCR amplification of the DAT-1 regulatory region found in cosmid T23G5.5 (refs. 27 and 28; T. Ishihara and I. Katsura, personal communication). The amplified product, containing 716 bp immediately upstream of the initiating codon ATG, was digested with HindIII and BamHI, and the resultant 0.7-kb fragment was cloned into the HindIII and BamHI sites of pPD95.73 (gift from A. Fire, Carnigie [sic] Institute of Washington, Baltimore), now called pRB490."