pC46H11BS1888

Reporter plasmid, pC46H11BS1888, CE1(bs258)::gfp was constructed by inserting the restriction fragments of pTNC2, BamH I-Sac I and BamH I-EcoR I, respectively, into BamH I-Sma I sites of pPD95.75, the promoterless gfp reporter plasmid (a generous gift from A. Fire). The construct was generated as translational fusions with gfp.

pC46H11BE1085

Reporter plasmids, pC46H11BE1085, delta[CE1(bs258)]::gfp were constructed by inserting the restriction fragments of pTNC2, BamH I-Sac I and BamH I-EcoR I, respectively, into BamH I-Sma I sites of pPD95.75, the promoterless gfp reporter plasmid (a generous gift from A. Fire). These constructs were generated as translational fusions with gfp.

pPD30.38

This vector contains <i>C. elegans</i> unc-54 promoter/enhancer sequences that produce high-level, muscle-specific gene expression (Fire et al., 1990).

pCL12

"The minigene encoding the beta-(1-42) peptide was assembled in thress steps. The artificial signal peptide coding sequence of vector pPD50.52 was amplified by using primers SP-up (5'-CGGGATTGGCCAAAGGACCC) and SP-down (5'-CCCGGTACCTGCTGGTGCCAGAAAGAT), cleaved with Nhe I and Kpn I restriction endonucleases, and inserted between the unique Nhe I and Kpn I sites of vector pPD49.26, resulting in construct pCL2. This procedure results in a reengineering of the signal peptide, such that the signal-peptide cleavage site, as predicted by the consensus of von Heijne (1986), occurs immediately after the Gly-Thr dipeptide encoded by the Kpn I site. A 146-bp fragment encoding beta-(1-42) (including an artificial stop codon) was amplified from human beta-amyloid precursor protein cDNA clone p4T4B (Ponte et al., 1988) by using primers Beta1-42-up (5'GGGGGTACCGATGCAGAATTCCGACATGA-3') and Beta1-42-down (5'CCCGAGCTCACGCTATGACAACACCGCCAA3'), cleaved with Kpn I and Sac I, and inserted between the unique Kpn I and Sac I sites of pCl2, generating pCL3. The signal peptide/Beta-(1-42) minigene fragment was removed from this plasmid by digestion with Nhe I and Sac I and inserted between the unique Nhe I and Sac I sites of pPD30.38 to construct pCL12. The sequence of the Beta-(1-42) minigene was confirmed by dideoxy DNA sequencing (coding strand only).Nhe I and Sac I sites of pPD30.38 to construct pCL12."

KG#687

Used Nhe I/ Age I to cut out the 0.9 Kb ssmCherry insert from KG#648 (unc-17 ::ssmCherry) and cloned it into the like-digested unc-129::vector KG#230 (6400 bp).

KG#731

Used Herculase II and primers engineered with restriction sites to amplify the 5.4 Kb SYD-2 gene from N2 genomic DNA and cloned it into Nhe I/ Kpn I cut KG#730 (6.0 Kb).

KG#751

Used Nhe I/ Age I to cut out the 1.1 Kb pst-2a cDNA from KG#740 (unc-17::PST-2A-GFP) and cloned it into the like-digested unc-129:: -GFP vector KG#367.

pJM66A

"pNSM/HSN (pJM66A) contains a 3124 bp fragment of the tph-1 promoter inserted into the Sph I site of pPD49.26. When the GFP coding sequence was inserted between the Kpn I and Sac I sites of pJM66A, the resulting plasmid gave robust GFP expression in the two NSMs and the two HSN neurons: no other expression was detected." (WBPaper00024411)

KG#717

Used Nhe I/ Kpn I to cut out the 2.7 Kb sad-1a cDNA from KG#696 (unc-17 ::sad-1a cDNA) and cloned it into the like-digested unc-129:: vector KG#230 (6400 bp). Transform into XL1-Blue electrocompetent cells.

KG#718

Used AffinityScript Multiple Temperature Reverse Transcriptase and a primer engineered with a restriction site to make the cdk-5 cDNA. Used Herculase II polymerase and primers engineered with restriction sites to amplify and clone the cDNA into Nhe I/ Kpn I cut KG#230.