pJT103

pJT77 was mutagenized using the primers efa-6delMTR-F [gagcccctcgccggaatgtcaacgtttcgagcacttatgcaaagcttctcggc] and efa-6delMTR-R [gcataagtgctcgaaacgttgacattccggcgaggggctccatcaatggtggc].

pJT102

pJT77 was mutagenized using the primers efa-6E447K-F [tccgtggtaaatcatcagctcgtgaacgtttgctc] and efa-6E447K-R [gctgatgaTTTaccacggagctctactcggctcaa].

pJT43

grp-1::gfp was amplified from SC-79 using primers B1grp-1gfpB2-F [ggggACAAGTTTGTACAAAAAAGCAGGCTatgtcatcgcggtattcagaacg] and B1gfpB2-R [ggggACCACTTTGTACAAGAAAGCTGGGTctatttgtatagttcatccatgccatgtgta], then recombined into pDONR 221.

#bgg1126

the unc-86 promoter was amplified from genomic DNA using primers B4punc-86B1-F [ggggACAACTTTGTATAGAAAAGTTGccactagtttctagtgaataaatcccc] and B4punc-86B1-R [ggggACTGCTTTTTTGTACAAACTTGcgtccgtggaaaagaggg], then recombined into pDONR P4P1R.

pJT9

unc-54 3'UTR was amplified from genomic DNA using primers B2unc-54B3-F [ggggACAGCTTTCTTGTACAAAGTGGcatctcgcgcccgtgcctct] and B2unc-54B3-R [ggggACAACTTTGTATAATAAAGTTGaaacagttatgtttggtatattgggaatgtattct], then recombined into pDONR P2RP3.

pJT48

cnt-2::gfp was amplified from Pmab-5::cnt-2::gfp 3 using primers B1cnt-2gfpB2-F [ggggACAAGTTTGTACAAAAAAGCAGGCTatgtcgcgacacctactaacagg] and B1gfpB2-R, then recombined into pDONR 221.

#bgg1127

the mab-5 promoter was amplified from pPD95.77 Pmab-5 using primers B4pmab-5B1-F [ggggACAACTTTGTATAGAAAAGTTGaagcttgattcagggtggtcgaca] and B4pmab-5B1-R [ggggACTGCTTTTTTGTACAAACTTGaatattttagttattaagattcca], then recombined into pDONR P4P1R.

pJT77

gfp::efa-6a cDNA was amplified from Ppie-1::gfp::efa-6a using primers B1gfpB2-F [ggggACAAGTTTGTACAAAAAAGCAGGCTatgagtaaaggagaagaacttttcactgga] and B1efa-6B2-R [ggggACCACTTTGTACAAGAAAGCTGGGTtcaatgagcagcagctccattaacagc], then recombined into pDONR 221.

pJT44

arf-6 was amplified from TOPO cloned arf-6 cDNA using primers B1arf-6B2-F [ggggACAAGTTTGTACAAAAAAGCAGGCTatgggtaaattcctgtcgaaaatct] and arf-6gfpR [tgaaaagttcttctcctttactcatcggcttgcaattctggcttagccac], and gfp was amplified from Pmab-5::cnt-2::gfp (Singhvi et al, 2011) using primers arf-6gfp-F[gtggctaagccagaattgcaagccgATGAGTAAAGGAGAAGAACTTTTCA] and B1gfpB2-R, then the two fragments were PCR-fused and the arf-6::gfp cDNA was amplified using B1arf-6B2-F and B1gfpB2-R, and finally recombined into pDONR 221.

pSOZ-101

A 1,500-bp promoter DNA just upstream of the translational start codon of emb-8 was PCR amplified using primers SOZ-205F/R [ATACTAGT(SpeI) CCCGGTCTCGACACAACAAAT/GCAGATCT(BglII)GTTTAGAATGAGAGTTTCTG].The PCR product was cloned using restriction enzyme sites SpeI/BglII to obtain plasmid pSOZ-79_emb-8p::3xflag::tev::gfp. pSOZ-79 was injected at 40 ng/uL into N2. Two independent lines ssdEx11 and ssdEx12 were obtained and yielded the same result. emb-8 cDNA was PCR-amplified using primers SOZ-204F/R [ATCCTGCAGG(SbfI)ATGCTGGCGTGGATTGTG/ATGCGGCCGC(NotI)TGACCACACATCAGC]. The cDNA was cloned into vectors through several steps to generate the final plasmid construct pSOZ-98_vha-6p::emb-8::mCherry (contains pCFJ151 backbone).