KG#804

Used the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) to insert a stop codon after the SYD-2 gene in KG#428 (unc-129::SYD-2-GFP).

pAZ81

pAZ81 is a derivative of pDP#MM016b that also contains the sup-7 suppressor tRNA gene

GBF336

The rescue construct GBF336 [punc-119::ceWDR79] for pan-neuronal expression of ceWDR79 was created by PCR fusion of two fragments: the promoter of the unc-119 gene and the ceWDR79 gene.

pGC220

Full FLP-out cassette construct: [Pgene of interest < reporter < gene-of-interest]

pMA83

Gateway expression construct. vps-53 is the second gene in an operon downstream of the gene gcc-2. For vps-53, 4502 bp upstream of the gcc-2 start codon was used as the promoter.

pC1

pCI is derived from pBX by removing a 1.5 kb BamHI/ClaI fragment upstream of the pha-l gene.

pPD30.38

This vector contains <i>C. elegans</i> unc-54 promoter/enhancer sequences that produce high-level, muscle-specific gene expression (Fire et al., 1990).

pPCZ1

Construct 48.1C contains the complete hsp16-48/1 gene pair of locus hsp16A (Russnak and Candido, 1985) and is an in-frame translational fusion of the lacZ coding region with the second exon of hsp16-1. The presence of an SV40 nuclear localization signal in the fusion targets lacZ expression to the nucleus, facilitating cell identification (Fire et al., 1990). pPCZ1 or 48.1C was constructed by inserting a 3500bp HindIII-AflI fragment encompassing the lacZ gene (nucleotides 18-3518 of the expression vector pPD16.43 received from A.Fire, Carnegie Institution) into the HpaI site (nucleotide 3565 of the published sequence) of the hspl6-1 gene. pPCZ1 contains a complete hspl6-48/1 gene pair extending from a BclI site at nucleotide 2280 to the BamHI site at nucleotide 4186 in the published sequence (Russnak and Candido,1985).

bGG836

To construct a plasmid (bGG836) containing the grp-1 genomic region [grp-1(+)], we used primers grp-1A [catcggttctggaaagcttatt] and grp-1B [ggttcaacaccttgcaaaaa] to amplify a 3.6 kb fragment of the genomic region spanning from the end of the gene upstream of grp-1 to the beginning of the immediate downstream gene. The PCR product was TOPO cloned to yield plasmid bGG836.

TU#939

Constructed using the plasmid vector pPD95.75 as a backbone. The 5' upstream region from the start of translation (ATG) to the adjacent gene was considered as the promoter region.