EM282 50 ng/ul

Clone = EM282 50 ng/ul | nIs118 is a derivative of nEx934, integrated using gamma irradiation. nEx934 was generated by injecting Robyn Lints' cat-2::gfp plasmid EM282 at a concentration of 50 ng/ul, with the lin-15 rescuing plasmid pL15EK at a concentration of 50 ng/ul. --Pers. Comm. from H. Schwartz 2003_0929. | Clone = pL15EK 50 ng/ul

WBCnstr00000332

The integrated glr-1::CFP strain was kindly provided by H. Hutter.

WBCnstr00006710

This transgens was made with plasmid PSH22 (gift from H. Sawa, RIKEN, Kobe, Japan) (Green et al., 2007).

WBCnstr00020480

To construct intestine specific cav-2 clones, we used Gateway multisite technology (Invitrogen, Paisley, UK). Individual entry clones containing the vha-6 promoter and cav-2 cDNA were produced and then combined in a Gateway reaction into the destination vector pHP2 (H. Peterkin and H. Baylis, unpublished data). The vha-6 promoter clone contained a fragment, similar to that previously used by Grant and colleagues (Chen et al., 2006), amplified using the oligonucleotides ggggacaagtttgtacaaaaaagcaggctcgcgttcaccactcgaccaccgaac and ggggacaacttttgtatacaaagttgttttttatgggttttggtaggttttag. The cav-2 cDNA was amplified using the oligonucleotides ggggacaacttttctatacaaagttgaaaaatgactcgtcagaatacttccgaaag and ggggacaactttattatacaaagttgttaaacatgatgaatgtgtttttc.

WBCnstr00022469

The paxt-1 promoter, H. sapiens C2AIL (codon optimized plus two artificial introns) coding sequence and tbb-2 3'-UTR sequences were cloned into pCFJ150 by Gateway cloning. An operon_GFP sequence between C2AIL and the tbb-2 3'UTR was included to permit visualization of transgene expression without altering the sequence of the encoded protein.

WBCnstr00010869

[K08F4.7::gfp]. Confocal laser-scanning microscopy was applied to examine the tissue distribution of the Ce-GST-p24-GFP fusion protein. Transgenic BL1 adults were oxidatively stressed with 200 M juglone for 1 h and were fixed 24 h after the stress induction. The entire Ce-GST-p24 gene, along with 1000 bp upstream of the start codon, was amplified from C. elegans genomic DNA by PCR [forward primer (with a Sal I specific restriction site): 5'-GGGTCGACTTATTGTGATCCGACTTTTATAGC-3'; reverse primer (with a Bam HI specific restriction site): 5'-GGGGATCCAACAATACTATCCTTTCTTGTTGCC-3']. The genomic amplification product was first A/T-ligated into the pGEM Teasy vector restricted with SalI/Bam HI, and ligated between the unique SalI/BamHI sites of pPD95.77. --precise ends.

WBCnstr00006497

The GFP-PEST reporter protein has a fluorescent half-life of less than 1 h in vivo. To append the PEST sequence to the C-terminus of GFP, nucleotides 1,399-1,521 of pd1EGFP-N1 (Clontech, Palo Alto, California, United States) were inserted into pPD95_81 (A. Fire) between the last coding codon and the stop codon of gfp, generating pAF207 (Frand et al., 2005).

WBCnstr00006887

The GFP-PEST reporter protein has a fluorescent half-life of less than 1 h in vivo. To append the PEST sequence to the C-terminus of GFP, nucleotides 1,399-1,521 of pd1EGFP-N1 (Clontech, Palo Alto, California, United States) were inserted into pPD95_81 (A. Fire) between the last coding codon and the stop codon of gfp, generating pAF207 (Frand et al., 2005).

WBCnstr00006888

The GFP-PEST reporter protein has a fluorescent half-life of less than 1 h in vivo. To append the PEST sequence to the C-terminus of GFP, nucleotides 1,399-1,521 of pd1EGFP-N1 (Clontech, Palo Alto, California, United States) were inserted into pPD95_81 (A. Fire) between the last coding codon and the stop codon of gfp, generating pAF207 (Frand et al., 2005).

WBCnstr00006891

The GFP-PEST reporter protein has a fluorescent half-life of less than 1 h in vivo. To append the PEST sequence to the C-terminus of GFP, nucleotides 1,399-1,521 of pd1EGFP-N1 (Clontech, Palo Alto, California, United States) were inserted into pPD95_81 (A. Fire) between the last coding codon and the stop codon of gfp, generating pAF207 (Frand et al., 2005).