pKK1503

Clone = pKK1503 | Expresses GFP in D-type motoneurons.

pMH86

A plasmid containing rescuing wild-type dpy-20 DNA. pMH86 is a Bluescript (SK+)-derived plasmid that has a 6-kb Xbal DNA insert containing the entire dpy-20 gene subcloned from a dpy-20-containing cosmid; D . Clark and D . Baillie, pers.comm.

pMG121

300bp upstream the ATG with a deleted unc-30 binding site toreduce expression in D-type motor neurons

TU#1177

A plasmid (TU#1177) containing mec-4p::mec-4(d) was generated by taking wild-type genomic DNA from 1019 bp upstream of the mec-4 start codon to 541 bp downstream of the stop codon and inserting it into pPD95.75 digested with BamHI and ApaI and producing the mec-4(d) mutation (A713T) using QuickChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara,CA).

pCL32

A flp-13 promoter fragment (-2296 bp relative to start) was cloned into pENTR-D-TOPO to generate a Gateway entry vector as described previously (Bhattacharya et al., 2014).

pAP43

A flp-13 promoter fragment (-2296 bp relative to start) was cloned into pENTR-D-TOPO to generate a Gateway entry vector as described previously (Bhattacharya et al., 2014).

pKS17

A destination vector, pPD117.01GtwyB(Asp718), was kindly provided by Barth D. Grant (Rutgers University, NJ, USA), and contained a Gateway cassette B upstream of GFP. The mec-7 promoter of pPD117.01GtwyB(Asp718) was replaced by the act-5 promoter (pKS17). The cDNA fragment of ifo-1 was cloned into pKS17 using Gateway recombination technology (Invitrogen).

fUL#JW82

Clone = fUL#JW82. The reporter gene fusion assayed was made by recombineering WRM0633bB04. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: taccggcgacggctactgaccggccgggtcacttgcgttcggacgacgac, catcttcgagagaagaagaagatgaagaagacgtgagatgacctacctcg. gfp was inserted immediately after the nhr-23c/d start codon. Other strains: UL3577, UL3578, UL3579. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends.

fUL#JW141

Clone = fUL#JW141. The reporter gene fusion assayed was made by recombineering WRM063aH01. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: ggttgaagaaaagctgacgttaaagaaaacagagtcgttgaccatcctgg, tcttctgtcatcagaatcgttgcttgtactagcggtgatacgcacacaga. gfp was inserted immediately after the syd-9c/d start codon. Other strains: UL3830, UL3842, UL3944, UL3945, UL3946, UL3963. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends.

NP403

ce-HisCl1 is a negative selection marker. HisCl1 is a D. melanogaster inhibitory histamine-gated chloride channel Ce-HisCl1. ce-HisCl1 was optimized for expression in C. elegans by including two early introns (from ama-1), which has been shown to increase gene expression (Aljohani et al., 2020). We also minimized the ribosomal binding site energy but did not codon-optimize the ce-HisCl1 transgene. ce-HisCl1 was generated by gene synthesis (TwistBiosciences, CA, USA) in a [1-2] Gateway Entry vector.