Clone = fUL#JW141. The reporter gene fusion assayed was made by recombineering WRM063aH01. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: ggttgaagaaaagctgacgttaaagaaaacagagtcgttgaccatcctgg, tcttctgtcatcagaatcgttgcttgtactagcggtgatacgcacacaga. gfp was inserted immediately after the
syd-9c/d start codon. Other strains: UL3830, UL3842, UL3944, UL3945, UL3946, UL3963. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends.