Sequence:
download
yk93g11.5Sequence.fasta
>Sequence ggtgtcggcgagaacgagtcgaccgtctatattctggattttggattcgccaggaaatttgtagacaaggagggcaaaat catcccgccgagaaccgctgcagcactgatgggaacttttcaatattgtgcagtttctgcccactctcacaaggaccaat gtgcacgggacgacttggaaagctggttttacatgggtattgagttgctcaagggaccacttccatgggcgaatatcgac ggtcacaagaatcacaagcagattggagaggcgaaagtcgcgattccgaagcgagccgcttcgatccgagttttttcgaa ggagtcccgaagcaatttaatgaaattcctcaacgattct
view Sequence (360 bp)
>Sequence
ggtgtcggcgagaacgagtcgaccgtctatattctggattttggattcgccaggaaatttgtagacaaggagggcaaaat
catcccgccgagaaccgctgcagcactgatgggaacttttcaatattgtgcagtttctgcccactctcacaaggaccaat
gtgcacgggacgacttggaaagctggttttacatgggtattgagttgctcaagggaccacttccatgggcgaatatcgac
ggtcacaagaatcacaagcagattggagaggcgaaagtcgcgattccgaagcgagccgcttcgatccgagttttttcgaa
ggagtcccgaagcaatttaatgaaattcctcaacgattct
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: