Sequence:
download
yk93g11.3Sequence.fasta
>Sequence tttatttacgagtaaaaatcgaataaatgtagtacaatttagtgcttcacttctccgttctcgcagtttcgacgtttttt gtacacgatttctccgcactgagcgatttagaaattccctcttgnggtggcatatcatcaaattcaatatccatcgactc attcgcattgtccttcgcatccaacttcgccgacgcttgatgagattctccgagttccccgacgaaaatcgccttgtgnt gcattctctcattattctgncagtccaaaggctctttcagtgtcacttgatgctccgtggcggnctgagacagcaaatca ccgagcttcttgtaattt
view Sequence (338 bp)
>Sequence
tttatttacgagtaaaaatcgaataaatgtagtacaatttagtgcttcacttctccgttctcgcagtttcgacgtttttt
gtacacgatttctccgcactgagcgatttagaaattccctcttgnggtggcatatcatcaaattcaatatccatcgactc
attcgcattgtccttcgcatccaacttcgccgacgcttgatgagattctccgagttccccgacgaaaatcgccttgtgnt
gcattctctcattattctgncagtccaaaggctctttcagtgtcacttgatgctccgtggcggnctgagacagcaaatca
ccgagcttcttgtaattt
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: