Sequence:
download
yk856c11.3Sequence.fasta
>Sequence ttggcgtttttatcttaataaatgatgattaagaaaaanaaaaacttttgtagtaggatagagggaatgggaaacaaaaa acaataacaataaaagaaaaagggtaacaatttcaacagaacaaccttaaaataaccaaaaaacaattattcatcatgct tctgaatgcatctcccgtacaaatgacatctggcacattgagcacagtgcacatatctcggcttgacacacttatcacat ttctcgcagtgattccattttccttgttccactgatgtgcacgcctggcaacgatcgcaatggacatttcgttcggtgac atagcgatcgcagacttcgcagaatttgtagccggcgacgttctttaaatcgatgcattccactggcaaatcggtgaaca ggcggacgatcgttttctcggaatgttgatagagcttgtggccctcgtaggtgactctgtaatcagacatccaaaagttt ccatgaagcacgtattttcgaatataaatcggcagaacaatcatcgaataaaataaggtttcctctttcccagttgacac aaatcgtttcttcatcttttcaatactttttagcagtggttccataaaaactccgaatggtggatcggtgatcattagga tgcttttgctttta
view Sequence (654 bp)
>Sequence
ttggcgtttttatcttaataaatgatgattaagaaaaanaaaaacttttgtagtaggatagagggaatgggaaacaaaaa
acaataacaataaaagaaaaagggtaacaatttcaacagaacaaccttaaaataaccaaaaaacaattattcatcatgct
tctgaatgcatctcccgtacaaatgacatctggcacattgagcacagtgcacatatctcggcttgacacacttatcacat
ttctcgcagtgattccattttccttgttccactgatgtgcacgcctggcaacgatcgcaatggacatttcgttcggtgac
atagcgatcgcagacttcgcagaatttgtagccggcgacgttctttaaatcgatgcattccactggcaaatcggtgaaca
ggcggacgatcgttttctcggaatgttgatagagcttgtggccctcgtaggtgactctgtaatcagacatccaaaagttt
ccatgaagcacgtattttcgaatataaatcggcagaacaatcatcgaataaaataaggtttcctctttcccagttgacac
aaatcgtttcttcatcttttcaatactttttagcagtggttccataaaaactccgaatggtggatcggtgatcattagga
tgcttttgctttta
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: