Sequence:
download
yk837d12.3Sequence.fasta
>Sequence atataataatgaaagaaagagtattcgagaacaatgtattggaatgtttcgagggattgaagtagtatcatgtgaggtat agattgcttgtgaaatcaaggctgagacattaaggaaacattttaacatattttgcaaagtcacacactgggaaaatggt aaacgggatgaataggtttgttttaatatgaacactagattatgataatatccgttccagacgcagagtacattgcttga gacctgagttgtgccctcctagtcgactgtcaataaaatcgattgttcttg
view Sequence (291 bp)
>Sequence
atataataatgaaagaaagagtattcgagaacaatgtattggaatgtttcgagggattgaagtagtatcatgtgaggtat
agattgcttgtgaaatcaaggctgagacattaaggaaacattttaacatattttgcaaagtcacacactgggaaaatggt
aaacgggatgaataggtttgttttaatatgaacactagattatgataatatccgttccagacgcagagtacattgcttga
gacctgagttgtgccctcctagtcgactgtcaataaaatcgattgttcttg
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: