Sequence:
download
yk830h08.5Sequence.fasta
>Sequence aaaaaaaaggtttaattacccaagtttgaggacgtaatgctcaacattttgatgtcaatgacgaaggaaggagcctccga tgggccgcagttcgtcgctcctgcaaaaacgagtcgagatacacttatcactactgcatatagattgcatcgaacgaggt ggagaatattggaaccttacagacgactaaagaatgcattgaaaaagttgcaagaagattatctgaaatcaaaggaagca aatgcattgatgagatatgtgaagttaggacaatctgttagagaagttgctatgctggaaaaacaatactggaaattatt aaatataccggctcaggagggaaccgaagatgcaaactgcta
view Sequence (362 bp)
>Sequence
aaaaaaaaggtttaattacccaagtttgaggacgtaatgctcaacattttgatgtcaatgacgaaggaaggagcctccga
tgggccgcagttcgtcgctcctgcaaaaacgagtcgagatacacttatcactactgcatatagattgcatcgaacgaggt
ggagaatattggaaccttacagacgactaaagaatgcattgaaaaagttgcaagaagattatctgaaatcaaaggaagca
aatgcattgatgagatatgtgaagttaggacaatctgttagagaagttgctatgctggaaaaacaatactggaaattatt
aaatataccggctcaggagggaaccgaagatgcaaactgcta
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: