Sequence:
download
yk80b1.3Sequence.fasta
>Sequence taattcaacaaataaaaaaatcgttagtnttgtttaatattcacataagtatataaaagtagttacagatttttaggcaa taattcgaaatttcttgggtcccgcgcagaaggtcgagcgattcaaattcgagattttcgaccgcgactttgtgctgctg aaggtgatgctctcgaagctgtccgactcgtatttgctctgcgattttcccgtcaaattgagaatgtccgatggatggac ggncacggcgcgggtgcatttgatgtaccagtttaaagcaatcataaaaatcgataatccgaaggcgcaattgatcagga tct
view Sequence (323 bp)
>Sequence
taattcaacaaataaaaaaatcgttagtnttgtttaatattcacataagtatataaaagtagttacagatttttaggcaa
taattcgaaatttcttgggtcccgcgcagaaggtcgagcgattcaaattcgagattttcgaccgcgactttgtgctgctg
aaggtgatgctctcgaagctgtccgactcgtatttgctctgcgattttcccgtcaaattgagaatgtccgatggatggac
ggncacggcgcgggtgcatttgatgtaccagtttaaagcaatcataaaaatcgataatccgaaggcgcaattgatcagga
tct
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: