Sequence:
download
yk806d10.3Sequence.fasta
>Sequence tttaatttaagaaaaattacatattacaataagatnatggttgttccaaagaccagttaggcttcttgcttgattccttc aaaaactagaactccgtgaatcggcttattttgagaagccatgcttttcatgaatactgtgtagtccttgagagcttctt tatagcgatttactgtttcttcattcgaaaagtcactgattccgtaggttggagtttgattagtctgttggtaggttgta cgtcccatttgttgcatttgagtattgctagccaagtttgtaattccaaagtcattctcatcgagtgcatttttaattga cgaagcaactaatccctcgataattttctttggtaaatctggctcggcggtgattgggcgtcccaatccgattccttggg tagcaccattttcaatagcttctaccattgctttcacggtacggaagccaccggtcaagtagacaacggttttcttgaaa actggacgaatcttttcggcgaattctaaaaagaaagcttcacggttacgagtcgaatcacgcatatgatggaaggcgag cttctcataagttcc
view Sequence (575 bp)
>Sequence
tttaatttaagaaaaattacatattacaataagatnatggttgttccaaagaccagttaggcttcttgcttgattccttc
aaaaactagaactccgtgaatcggcttattttgagaagccatgcttttcatgaatactgtgtagtccttgagagcttctt
tatagcgatttactgtttcttcattcgaaaagtcactgattccgtaggttggagtttgattagtctgttggtaggttgta
cgtcccatttgttgcatttgagtattgctagccaagtttgtaattccaaagtcattctcatcgagtgcatttttaattga
cgaagcaactaatccctcgataattttctttggtaaatctggctcggcggtgattgggcgtcccaatccgattccttggg
tagcaccattttcaatagcttctaccattgctttcacggtacggaagccaccggtcaagtagacaacggttttcttgaaa
actggacgaatcttttcggcgaattctaaaaagaaagcttcacggttacgagtcgaatcacgcatatgatggaaggcgag
cttctcataagttcc
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: