Sequence:
download
yk792g03.3Sequence.fasta
>Sequence acttgtgcaaagaatggcgagnaaaaaaaattgtgagaacctatggaagcttagtaaaaagagacaatttagacgagcaa agatttaatatagaccatgagaacatttacaataccgagtaagtgtaacacacaaaaaaaagtattatgacagacagaaa aaagtagtcgctatggagacatcaaaacttttcagaacatgtgtgagtcggcgctttcttcttcaacagattccaaaatt gcagaactttcaacggtcgaacgatgacgagcgagaacacggagaagtggacgcagagccatccaccattgctctgatgg aagacgatgctcaaaatcggtctccttcttgagatcttgcaccggcgtgaacaccacctttcgtcctttgagtccaagaa gcgtcgcagtatgggctgacttggcgatcaccttgttatcggccgtcaaattttccttgagctgaatgagcaaaaactcc aaagcacgagcggccagcttggttcccatatttctgtcgaacggcgttggagatccaccctgttgaacatgtccgagaac attgactcttgtggtgaagttcttctttccttcagaatcaaaaagattctgcacaaaatctgtggtgaggttcttgtcgg cccactcattt
view Sequence (651 bp)
>Sequence
acttgtgcaaagaatggcgagnaaaaaaaattgtgagaacctatggaagcttagtaaaaagagacaatttagacgagcaa
agatttaatatagaccatgagaacatttacaataccgagtaagtgtaacacacaaaaaaaagtattatgacagacagaaa
aaagtagtcgctatggagacatcaaaacttttcagaacatgtgtgagtcggcgctttcttcttcaacagattccaaaatt
gcagaactttcaacggtcgaacgatgacgagcgagaacacggagaagtggacgcagagccatccaccattgctctgatgg
aagacgatgctcaaaatcggtctccttcttgagatcttgcaccggcgtgaacaccacctttcgtcctttgagtccaagaa
gcgtcgcagtatgggctgacttggcgatcaccttgttatcggccgtcaaattttccttgagctgaatgagcaaaaactcc
aaagcacgagcggccagcttggttcccatatttctgtcgaacggcgttggagatccaccctgttgaacatgtccgagaac
attgactcttgtggtgaagttcttctttccttcagaatcaaaaagattctgcacaaaatctgtggtgaggttcttgtcgg
cccactcattt
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: