Sequence:
download
yk789d07.5Sequence.fasta
>Sequence cttaacttccttttggaaatcgccagtccaaactcgacggttgtcgaaggaatttgctcattatttgctcgttacgaaca atgtctatctgcaactgtattcaaaaattctcaacgctgctcgtttgcttctccactcaattcactcgccagaatcggtc tcgcaccaatctgttccctggattcccgaccattgttgtcaaagcacagagattgtttcgagaagcttgccacagaagct gatgaagatacaaattgccaatcatctctttcaactctctcaaatacagttcaaatgatgcttcagggagttcacggaga agctcttctatgtaaatctttctacacaatcagagatactttcacttgtggagaaagagctgttaagaacaaatgtgaag ctgatgcattgactgatttgctt
view Sequence (423 bp)
>Sequence
cttaacttccttttggaaatcgccagtccaaactcgacggttgtcgaaggaatttgctcattatttgctcgttacgaaca
atgtctatctgcaactgtattcaaaaattctcaacgctgctcgtttgcttctccactcaattcactcgccagaatcggtc
tcgcaccaatctgttccctggattcccgaccattgttgtcaaagcacagagattgtttcgagaagcttgccacagaagct
gatgaagatacaaattgccaatcatctctttcaactctctcaaatacagttcaaatgatgcttcagggagttcacggaga
agctcttctatgtaaatctttctacacaatcagagatactttcacttgtggagaaagagctgttaagaacaaatgtgaag
ctgatgcattgactgatttgctt
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: