Sequence:
download
yk766d01.3Sequence.fasta
>Sequence taaagtttgcaattgggagaagaaaaaaaaagacaaatcgaaataaaaacatgggaaattaattttaaaaacagttttca gaaaataaaatgggaaaggggcagcagaaaccgggattttctcatgataaggacaagacgcaaatcgaggaagatggggg aaaaatgattgagacacggaaaaagtatgaaaattaaaaactactcgacattagtgaaactatgtttgttgtacaagttg aaattaaattctagcgaacgaggaacaaagtttaaatatagaaaaaaatgcgcggtgtaaaagcagtaaattagaaaaga attagagggtagtttgacgataaaaaacgatatattagttgcacttatataaacttaaaattgtaaagaaataatgcaaa atgtatacagctagttgacaatgtgtgaaagaaatgttttttgagtagaaagaatgttgggaaaacggatgaataaatta gaagagaagagaaaaaaaagttggactgtacgacacaaaaggctagcggtgggatgggatggtagatgtacaaatacatg aaatttgaaagaaagcatgcagatttcacaaatcaaataagttagatctactcggaatttgaacattattgtacaatttt gtgggtt
view Sequence (647 bp)
>Sequence
taaagtttgcaattgggagaagaaaaaaaaagacaaatcgaaataaaaacatgggaaattaattttaaaaacagttttca
gaaaataaaatgggaaaggggcagcagaaaccgggattttctcatgataaggacaagacgcaaatcgaggaagatggggg
aaaaatgattgagacacggaaaaagtatgaaaattaaaaactactcgacattagtgaaactatgtttgttgtacaagttg
aaattaaattctagcgaacgaggaacaaagtttaaatatagaaaaaaatgcgcggtgtaaaagcagtaaattagaaaaga
attagagggtagtttgacgataaaaaacgatatattagttgcacttatataaacttaaaattgtaaagaaataatgcaaa
atgtatacagctagttgacaatgtgtgaaagaaatgttttttgagtagaaagaatgttgggaaaacggatgaataaatta
gaagagaagagaaaaaaaagttggactgtacgacacaaaaggctagcggtgggatgggatggtagatgtacaaatacatg
aaatttgaaagaaagcatgcagatttcacaaatcaaataagttagatctactcggaatttgaacattattgtacaatttt
gtgggtt
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: