Sequence:
download
yk750b12.5Sequence.fasta
>Sequence ggtttaattacccaagtttgagctgcaatatgaactggcaaagcctagaaccgaagcatatcatcaatgataatgtttat ggaaccgtcaaagtgccgagaccaatcgacaaattaattgatactgtggaatttcaacggctgcgtcatctgaaacagac tggactcgtctatcttgtgtatccaaattgtgagcactcgagatttgtgcattcgctgggaaccttctcactcgcctacg cgcttgtcgataagctcagacatagtcaaccatcactaaatatcacagaatctgatcttatctgcacatcagttgctgct ctacttcatgatgttggacatggaccattctctcatctgtttgatggagaattcgcaaaacgcaatggaagcagattcaa gcatgaggatatgtctattttaatcatcaagaaaatcatgaataaaccagaaataaaatctgaatttgcttgcattcttg gtgaaactgacgaagagtatgcaaaaagtgttacgcttatcacagaacttatcagcggaaaaccatttgatttccaagat atggacggatttaaagatttgcctgctgacgtgcgtgaggaaacagtcaaaaatgaatgggctatcattggctgtgga
view Sequence (638 bp)
>Sequence
ggtttaattacccaagtttgagctgcaatatgaactggcaaagcctagaaccgaagcatatcatcaatgataatgtttat
ggaaccgtcaaagtgccgagaccaatcgacaaattaattgatactgtggaatttcaacggctgcgtcatctgaaacagac
tggactcgtctatcttgtgtatccaaattgtgagcactcgagatttgtgcattcgctgggaaccttctcactcgcctacg
cgcttgtcgataagctcagacatagtcaaccatcactaaatatcacagaatctgatcttatctgcacatcagttgctgct
ctacttcatgatgttggacatggaccattctctcatctgtttgatggagaattcgcaaaacgcaatggaagcagattcaa
gcatgaggatatgtctattttaatcatcaagaaaatcatgaataaaccagaaataaaatctgaatttgcttgcattcttg
gtgaaactgacgaagagtatgcaaaaagtgttacgcttatcacagaacttatcagcggaaaaccatttgatttccaagat
atggacggatttaaagatttgcctgctgacgtgcgtgaggaaacagtcaaaaatgaatgggctatcattggctgtgga
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: