Sequence:
download
yk750b12.3Sequence.fasta
>Sequence tcgaaaggcaaattgcatacagaaaatgcgaaaacttctaaccgtttcttctttgtaagaagctaagatgtggtaccaat acagaaaaatcattgggtgaatgttgagcaggaggaggcagtaaaatgtataatttgatgtgtatatgtaaagtacattt aaaatatgattattatgagctaccaaattcgagacgacgtttggcagtggagcagctcgatgaaacttcatcaggagaat cttgcggagatctttttcgtggggtcaaaaacttttcagactccccagcaagttgaagtgcacgcttcacgcgatccgct aacagtggctctttcctcaaactacgatctcccatcacgaagatttcccattttgtggccatgcgagggcaattgttgat aacataatcttcagatggatagaatccgacaacttgtttcccttcatgctcactcggttttccatcgtagaaaatctgac gttcgattggatgagttttatcgtccaaacctctaccaaggacggaatgcattacagtgaactgaatatccttcagtttt ccatccatttcttcagtatcatccatttgctccaaaatttctttcatcttttgtccaacttttttgacaactt
view Sequence (633 bp)
>Sequence
tcgaaaggcaaattgcatacagaaaatgcgaaaacttctaaccgtttcttctttgtaagaagctaagatgtggtaccaat
acagaaaaatcattgggtgaatgttgagcaggaggaggcagtaaaatgtataatttgatgtgtatatgtaaagtacattt
aaaatatgattattatgagctaccaaattcgagacgacgtttggcagtggagcagctcgatgaaacttcatcaggagaat
cttgcggagatctttttcgtggggtcaaaaacttttcagactccccagcaagttgaagtgcacgcttcacgcgatccgct
aacagtggctctttcctcaaactacgatctcccatcacgaagatttcccattttgtggccatgcgagggcaattgttgat
aacataatcttcagatggatagaatccgacaacttgtttcccttcatgctcactcggttttccatcgtagaaaatctgac
gttcgattggatgagttttatcgtccaaacctctaccaaggacggaatgcattacagtgaactgaatatccttcagtttt
ccatccatttcttcagtatcatccatttgctccaaaatttctttcatcttttgtccaacttttttgacaactt
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: