Sequence:
download
yk743g2.5Sequence.fasta
>Sequence aaaactcgaataaagaaatcaatattcgtattgtttatttcgtctgaaattattcgtttcttcgaagaattcttctcaaa atgggccttgtggattacgcaggaagtgaatcagaaagtgatgaagaaatggaaacacaacaaaaaaattcactcgctcc acaaaatcaacaactcgtcgatgatgaagcattttttgacaatacagaaaaatcaagctcaccaaacatgaacaaagaag atgttctcgaagaattagtaaaaccgaaagaatgggaggttaaattggccgagaaagcaaggagaaagctggagaaaaaa gctctgaaaaaagcacaa
view Sequence (338 bp)
>Sequence
aaaactcgaataaagaaatcaatattcgtattgtttatttcgtctgaaattattcgtttcttcgaagaattcttctcaaa
atgggccttgtggattacgcaggaagtgaatcagaaagtgatgaagaaatggaaacacaacaaaaaaattcactcgctcc
acaaaatcaacaactcgtcgatgatgaagcattttttgacaatacagaaaaatcaagctcaccaaacatgaacaaagaag
atgttctcgaagaattagtaaaaccgaaagaatgggaggttaaattggccgagaaagcaaggagaaagctggagaaaaaa
gctctgaaaaaagcacaa
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: