Sequence:
download
yk702h7.5Sequence.fasta
>Sequence agagtnctgctcaaaatgttgaaacaaattcttctngtcgctattattttaaatttaggagtatctgcgtataagaagaa aagcttgattcataatcatgacaaagtgatcgtatcaaacgacgactttattggatgcccagttaacaatgatttctatt acaatggaaccattaattcaccattgtatccatacaattatcctccaaatgacaagtgttactattacatttctgctgaa ccaggaaaagttctcaagatttcattctctcattttgatttggaatcttgctgtgacttcatcacaatttatgatggacc aact
view Sequence (324 bp)
>Sequence
agagtnctgctcaaaatgttgaaacaaattcttctngtcgctattattttaaatttaggagtatctgcgtataagaagaa
aagcttgattcataatcatgacaaagtgatcgtatcaaacgacgactttattggatgcccagttaacaatgatttctatt
acaatggaaccattaattcaccattgtatccatacaattatcctccaaatgacaagtgttactattacatttctgctgaa
ccaggaaaagttctcaagatttcattctctcattttgatttggaatcttgctgtgacttcatcacaatttatgatggacc
aact
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: