Sequence:
download
yk53h11.5Sequence.fasta
>Sequence gaacactacttcataaagctgttgagctagatgctgctgatagtgtagcttctttgctttccggaggtgtaaatccatgt gtacaaaacttggatggtaaaacagnctatcaatgctgcaaatcagaaaatgttcggttgtcattcgtccgagaagcttt gnagtcaattaacatgaacaaaactgaacgtctatgccaacttattcgtgccggagtacacgttgattcgttcgacacga cacaaacaaagaatacacttttanattgggctgctgattttgctacattggaagttgtnaaagcattgctcacaaatggc gccactgttt
view Sequence (330 bp)
>Sequence
gaacactacttcataaagctgttgagctagatgctgctgatagtgtagcttctttgctttccggaggtgtaaatccatgt
gtacaaaacttggatggtaaaacagnctatcaatgctgcaaatcagaaaatgttcggttgtcattcgtccgagaagcttt
gnagtcaattaacatgaacaaaactgaacgtctatgccaacttattcgtgccggagtacacgttgattcgttcgacacga
cacaaacaaagaatacacttttanattgggctgctgattttgctacattggaagttgtnaaagcattgctcacaaatggc
gccactgttt
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: