Sequence:
download
yk53h11.3Sequence.fasta
>Sequence tatacacgaattagaaacaaaagggcaggcgatagaaaataaggcagtaaacgtcaattaataaactccatggaaaaaaa taaattaaggctatttaacaaatcacagcggggnggagagatatcacatttttaatacatcgataggttcgattccatca caataattgtttacccatttcttgtaaatcatgaggcaatagtgctctgaacaaattatcgaacatngtgagagcattct gcagagtacttggaattgatcgggataaccaaacatgttgaaattggncacggacgcgtagcattgtattagncaaatca gtgcgaattgcag
view Sequence (333 bp)
>Sequence
tatacacgaattagaaacaaaagggcaggcgatagaaaataaggcagtaaacgtcaattaataaactccatggaaaaaaa
taaattaaggctatttaacaaatcacagcggggnggagagatatcacatttttaatacatcgataggttcgattccatca
caataattgtttacccatttcttgtaaatcatgaggcaatagtgctctgaacaaattatcgaacatngtgagagcattct
gcagagtacttggaattgatcgggataaccaaacatgttgaaattggncacggacgcgtagcattgtattagncaaatca
gtgcgaattgcag
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: