Sequence:
download
yk282d10.3Sequence.fasta
>Sequence ttccactggatatgtatataagtgaactggtaagaaaggatatggaagtttgcaagttgcattaaatgttgtcggaggga taaaggatgtgtcgcttcccgcatttatgatcccaacactttaacgtggggtaacctggacagagagatatattgggaag tttccgctgccaaaatggtgcagtgactgtttttttttcaagttttcgcacaactccatcatgagcgaatgggcaaatct gtggggcaatacaatgcccgtatttgtgtnaaatgcatncttgattcnacgatgaaggta
view Sequence (300 bp)
>Sequence
ttccactggatatgtatataagtgaactggtaagaaaggatatggaagtttgcaagttgcattaaatgttgtcggaggga
taaaggatgtgtcgcttcccgcatttatgatcccaacactttaacgtggggtaacctggacagagagatatattgggaag
tttccgctgccaaaatggtgcagtgactgtttttttttcaagttttcgcacaactccatcatgagcgaatgggcaaatct
gtggggcaatacaatgcccgtatttgtgtnaaatgcatncttgattcnacgatgaaggta
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: