Sequence:
download
yk18a10.3Sequence.fasta
>Sequence attcaatatatgaattacaaaaatatacattcttgataaattagcaatttctcctgtttaaaatggcgtgtaggtctttt ggaaaaacgccaacgttatccttcttgtccagatttggaaatactttggaagacggtgagatcttgtatctattgaaaaa attcgccaaaaagaggaatatctccatccgcgcaagcccttctcccgggcattgccgctttccgattgagaatgggatga gctgctcgatcttgataggttttccattctcgtctatgaatctatcagggtntgaatttatatggctctgggaaagattt tctcatctagcataact
view Sequence (337 bp)
>Sequence
attcaatatatgaattacaaaaatatacattcttgataaattagcaatttctcctgtttaaaatggcgtgtaggtctttt
ggaaaaacgccaacgttatccttcttgtccagatttggaaatactttggaagacggtgagatcttgtatctattgaaaaa
attcgccaaaaagaggaatatctccatccgcgcaagcccttctcccgggcattgccgctttccgattgagaatgggatga
gctgctcgatcttgataggttttccattctcgtctatgaatctatcagggtntgaatttatatggctctgggaaagattt
tctcatctagcataact
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: