Sequence:
download
yk1751g02.5Sequence.fasta
>Sequence ttaaccaagatgcaacaacaacacaactcattatgatgaacatgtccgatccgaaacaacaacaacaacaaaagatccac gtgggcgccgccgtggttcttctcacggcgatcttctacgcggccgactttggattcgtatcgattctcgtcgtaatcgg ctcactgctcgccggaattctcttcgcaaaatgggtattcgagtgttcgaacggagagatgctataccaatggaaggact acttcaatccgtctgccaccacgtcatcaaggaagccagaagccgaagaagctgacgacgacgatgatgatgccaggctg gattcggagaagacccgacggatgccttggcagggcctcagcctaccggcttcactgaacgaggccgtcgaaaatttgct gaacgagattgtcgagcaatatgtgaatgggtggtatggaggggcgattagcagggatcgagcttttattaacgagatac ggtaccaactccgctacgcatcggccaacctcatccggtgcatccgacgcgtcgatctcgccgaattcgtctccgatc
view Sequence (558 bp)
>Sequence
ttaaccaagatgcaacaacaacacaactcattatgatgaacatgtccgatccgaaacaacaacaacaacaaaagatccac
gtgggcgccgccgtggttcttctcacggcgatcttctacgcggccgactttggattcgtatcgattctcgtcgtaatcgg
ctcactgctcgccggaattctcttcgcaaaatgggtattcgagtgttcgaacggagagatgctataccaatggaaggact
acttcaatccgtctgccaccacgtcatcaaggaagccagaagccgaagaagctgacgacgacgatgatgatgccaggctg
gattcggagaagacccgacggatgccttggcagggcctcagcctaccggcttcactgaacgaggccgtcgaaaatttgct
gaacgagattgtcgagcaatatgtgaatgggtggtatggaggggcgattagcagggatcgagcttttattaacgagatac
ggtaccaactccgctacgcatcggccaacctcatccggtgcatccgacgcgtcgatctcgccgaattcgtctccgatc
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: