Sequence:
download
yk1751g02.3Sequence.fasta
>Sequence caagaggaaactgaataaaaaaaatgatcaggggaaacggcgggaatgtttggttttttgctctaatagatggcacaaag aaaattggaaaataagaaaatattttcgaaaaataaaaaaaataaatacaaagtacaatgcctgcctacaggggcctatt gtagcgggtgctggccgaattcatcgagttctgggaaaatttgtaggaggaggcggtcgacgagcacgtagagcaactgt ttgttgagccgtgggtactgtagaacgtcgattatgcgcgagatgagtgtcttgatgtcgtcacggccgattaggcggcg agcgtgctgggggatattattctgaaaaaactccaacgtgatcctcaacgcgagttcttcccgcatcttcatctcctgct ccgtcggccatggtgcatcattgcagaacagagaccattgaatgtgttgaactagataagtgaggtttgcaaccgacaag cacttccggaagacaccaccgagcaccgagcaaatcattgaatcaatagtcttgctgcacagagcacggatcgctgagaa tatgggaagcgcccattgaaactgggtctttagaggttgccagaagagaaggagaatcgagtcgtacgcagatcttgtcc ataaccgcatatcctcatcgcctaaacttctacaggattccttgaaaactccgtcgaaattattcccatagaccgatgaa tagactgcattcgtcgcaagcgaatagctcgtcgtcgcgtcttc
view Sequence (764 bp)
>Sequence
caagaggaaactgaataaaaaaaatgatcaggggaaacggcgggaatgtttggttttttgctctaatagatggcacaaag
aaaattggaaaataagaaaatattttcgaaaaataaaaaaaataaatacaaagtacaatgcctgcctacaggggcctatt
gtagcgggtgctggccgaattcatcgagttctgggaaaatttgtaggaggaggcggtcgacgagcacgtagagcaactgt
ttgttgagccgtgggtactgtagaacgtcgattatgcgcgagatgagtgtcttgatgtcgtcacggccgattaggcggcg
agcgtgctgggggatattattctgaaaaaactccaacgtgatcctcaacgcgagttcttcccgcatcttcatctcctgct
ccgtcggccatggtgcatcattgcagaacagagaccattgaatgtgttgaactagataagtgaggtttgcaaccgacaag
cacttccggaagacaccaccgagcaccgagcaaatcattgaatcaatagtcttgctgcacagagcacggatcgctgagaa
tatgggaagcgcccattgaaactgggtctttagaggttgccagaagagaaggagaatcgagtcgtacgcagatcttgtcc
ataaccgcatatcctcatcgcctaaacttctacaggattccttgaaaactccgtcgaaattattcccatagaccgatgaa
tagactgcattcgtcgcaagcgaatagctcgtcgtcgcgtcttc
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: