Sequence:
download
yk1745g09.3Sequence.fasta
>Sequence ttgtaaaacaaattttgaagaaaaaaaacatgataaaataaaaatgaacaattacttgtgctttgaatttgagaaacgaa gagggacaagttccagaaaagggacaaccgtaggaggaatgaatgaatgacaaaacgagtgaaaaagaatggaagaatta tgaatgaaaattctatggctctgaaaactcatgaaaaatcacagaaacatttaaatagacatcaatcagcaaaaaaatct acaaagatttcaacagaaattcacaaaagacactctaaaaaaagggctggagacaaaagagattcatgtcaaaattaggc aatacttactagaaaaaacatgagtatctatacacaatttacacaatttctattcgctttgatcatccatcaaatctgct ttcgttctctcagcattctcaatttgagacatcagattttccagacgacgcttgatgcgtttctgatcatcagcagcgca ctgaattatgatcttcaagaagttttggcaggtggctccagcagtttcttcgtacgaacaggcgttcatgtaggtttgta ggcacagcttagccttttcaatattcgaatgcatcatttctccgacttcatcgatcatcaaagttgcatcttccagtgct tttttctgttcttcatttcgtggagtttcgacaacaacttgaactgtctttgttctttttgtcaatcggtcagtgattgc ttcaatctcttcacgatcacattcttccagtttgaacatgcagttatgaacactgatttc
view Sequence (780 bp)
>Sequence
ttgtaaaacaaattttgaagaaaaaaaacatgataaaataaaaatgaacaattacttgtgctttgaatttgagaaacgaa
gagggacaagttccagaaaagggacaaccgtaggaggaatgaatgaatgacaaaacgagtgaaaaagaatggaagaatta
tgaatgaaaattctatggctctgaaaactcatgaaaaatcacagaaacatttaaatagacatcaatcagcaaaaaaatct
acaaagatttcaacagaaattcacaaaagacactctaaaaaaagggctggagacaaaagagattcatgtcaaaattaggc
aatacttactagaaaaaacatgagtatctatacacaatttacacaatttctattcgctttgatcatccatcaaatctgct
ttcgttctctcagcattctcaatttgagacatcagattttccagacgacgcttgatgcgtttctgatcatcagcagcgca
ctgaattatgatcttcaagaagttttggcaggtggctccagcagtttcttcgtacgaacaggcgttcatgtaggtttgta
ggcacagcttagccttttcaatattcgaatgcatcatttctccgacttcatcgatcatcaaagttgcatcttccagtgct
tttttctgttcttcatttcgtggagtttcgacaacaacttgaactgtctttgttctttttgtcaatcggtcagtgattgc
ttcaatctcttcacgatcacattcttccagtttgaacatgcagttatgaacactgatttc
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: