Sequence:
download
yk1736b11.3Sequence.fasta
>Sequence attgtctgacaagttgagaagggtcttggtaaagagcattaggtgggagatcctggtatcagaattcgaatgggatgaaa atttcatggtgcaacaggaaagaaacacaggtaaccgtcttgtgaagggcatgattgggacaaaggagtaataagaataa tgggaaacaaggagggcaggggggaatgaccgtttttttctgtatcgaaggacagggtctaaaatgagatatgcaaataa atgtatccatgatttgtgtggaaagaggaagcaaataaaacaaagtgattaatttttgcattataattatacaacaaaga aaccaagcattgggagtttgacaactagagaatagcaaaaagagatctgaagcgaacatcttgggttcacttatcgcatc catctttatcgtctttcattttctctgctggagtttccacatcttgttctttggaggttttctccaatagggcttctcct gccgcatcagcacatggcttattcgattggttggtgcacacaccaactccaaaaactctttgaacatcactacgagaaac aggctgatgctcattttgagctgctactccattcgactttgaaagaaaattttcattttgtgttcgctgagtctcattac tacg
view Sequence (644 bp)
>Sequence
attgtctgacaagttgagaagggtcttggtaaagagcattaggtgggagatcctggtatcagaattcgaatgggatgaaa
atttcatggtgcaacaggaaagaaacacaggtaaccgtcttgtgaagggcatgattgggacaaaggagtaataagaataa
tgggaaacaaggagggcaggggggaatgaccgtttttttctgtatcgaaggacagggtctaaaatgagatatgcaaataa
atgtatccatgatttgtgtggaaagaggaagcaaataaaacaaagtgattaatttttgcattataattatacaacaaaga
aaccaagcattgggagtttgacaactagagaatagcaaaaagagatctgaagcgaacatcttgggttcacttatcgcatc
catctttatcgtctttcattttctctgctggagtttccacatcttgttctttggaggttttctccaatagggcttctcct
gccgcatcagcacatggcttattcgattggttggtgcacacaccaactccaaaaactctttgaacatcactacgagaaac
aggctgatgctcattttgagctgctactccattcgactttgaaagaaaattttcattttgtgttcgctgagtctcattac
tacg
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: