Sequence:
download
yk1655c03.5Sequence.fasta
>Sequence aataatctcgaaattaatttctgacaaccatatagataaggatcattctcgcgtgttttagagacgaaaatggtggaagc acccagttttcggatgatctgtgttgctgtcataacttcaattgcaggatcatttcatttcggtttcaacctggttctaa ctaatccatcacaagaagcattcttgaattttatgaatcaaacattggcaaagcgattcgacggtggattgagtgataac acattacagaatatttggagttttgtagttgcgattttgtttttgggagcacttgctggctcattttcaattcgattaat tgccgactggataggaagaaaaaatggattgtacatttcaattgctgtaggagttctggctggtggtatgtcaattgcat caaaatttataccactattcgaactctacattgcttcaagaattgtaatggggtggtcagtatctgtgagtctcggtctc tcggcactattcctctcggaagcaagcccgaaacaaaatcgcggtgcaattggaatgatgactggaacttgtgttcaact cggaactg
view Sequence (568 bp)
>Sequence
aataatctcgaaattaatttctgacaaccatatagataaggatcattctcgcgtgttttagagacgaaaatggtggaagc
acccagttttcggatgatctgtgttgctgtcataacttcaattgcaggatcatttcatttcggtttcaacctggttctaa
ctaatccatcacaagaagcattcttgaattttatgaatcaaacattggcaaagcgattcgacggtggattgagtgataac
acattacagaatatttggagttttgtagttgcgattttgtttttgggagcacttgctggctcattttcaattcgattaat
tgccgactggataggaagaaaaaatggattgtacatttcaattgctgtaggagttctggctggtggtatgtcaattgcat
caaaatttataccactattcgaactctacattgcttcaagaattgtaatggggtggtcagtatctgtgagtctcggtctc
tcggcactattcctctcggaagcaagcccgaaacaaaatcgcggtgcaattggaatgatgactggaacttgtgttcaact
cggaactg
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: