Sequence:
download
yk1655c03.3Sequence.fasta
>Sequence taatacccgcaaataatttgaatagcatctaattttcgttcttttaaaaattaattgaaaatctagagtcgataagataa ggattctatcgagccataatctacaactaattgcatttgcctcgacaaaaccatttcttgagattgtttcctatcatata cacgattttttccacataacgggaactttggaagatcttcaatcgcttcctccacctcaaatggatttttgtttttagtt tctggaagcgagaagtacaaataaacaagtgatgcggcgacgggggcgacgaaaagaataagataagaccatgcttctcc aagttgatttttcattggcagaaatgcggtgacaatgacgaatcgagagagcatttgaataacactggcccaactttgcg cggcacttcgagcagcttgtcccaccaactcggcgttgataaaatagcacaaaggtccggggccgagagcgaagaaaaac gtgaaaatacaaatgaagcagatgagaatgaatccaagaacatgattctcaaacttataaaacgtgaacatcaacgcaaa aataatcaaattacagacaagaattcctgcaaacgaaatgagaagaagtggtcgtcttccatttctatccacaattacag cagcaacaattgatgatatcatgctcacaacggaaattgcatcgtttgcaagtgatgcttctagaactttcaaaccagta tccttca
view Sequence (727 bp)
>Sequence
taatacccgcaaataatttgaatagcatctaattttcgttcttttaaaaattaattgaaaatctagagtcgataagataa
ggattctatcgagccataatctacaactaattgcatttgcctcgacaaaaccatttcttgagattgtttcctatcatata
cacgattttttccacataacgggaactttggaagatcttcaatcgcttcctccacctcaaatggatttttgtttttagtt
tctggaagcgagaagtacaaataaacaagtgatgcggcgacgggggcgacgaaaagaataagataagaccatgcttctcc
aagttgatttttcattggcagaaatgcggtgacaatgacgaatcgagagagcatttgaataacactggcccaactttgcg
cggcacttcgagcagcttgtcccaccaactcggcgttgataaaatagcacaaaggtccggggccgagagcgaagaaaaac
gtgaaaatacaaatgaagcagatgagaatgaatccaagaacatgattctcaaacttataaaacgtgaacatcaacgcaaa
aataatcaaattacagacaagaattcctgcaaacgaaatgagaagaagtggtcgtcttccatttctatccacaattacag
cagcaacaattgatgatatcatgctcacaacggaaattgcatcgtttgcaagtgatgcttctagaactttcaaaccagta
tccttca
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: