Sequence:
download
yk1629h02.5Sequence.fasta
>Sequence cgttatcaactgccatatacaaatcgggaactgttccacatgatgcaagtgtgccaggagttgttcataacttttgttcc gtcaattgatactcaatcaaattatctggagggcgatcaagcaagaattatcatcgaccaatttttagatgactttccat tatgcaaagtagttcattttggaccaaatcttgccagtcttttgattgcagataggaaacttttgacatcgattcaacgc cgtattccacgtatttatctctccacacatgttgatgaaaagaatgggcctcttctctctacacttcctccattcgttac gttgtgtgtagaaggaacttggccatttgaagtagaaagatatgtttcacctcgggtttctgttgtaattaagttctcga ctggtgacgacggatatttgtgtgcttcacctgaatcagttgccaagaaagcacttttggcagcaaaactgagtgatcgc cagactgttcttggatcgatggtttgcgacttatccactggatgtgaagctatgcctccttccctttcatacatgtccct tcttgcatctgttggtgttgcgtataatagctcaactgatatgaagaaatatgcatttttgcttcctgttatcgcagcac atcacatgctccttgac
view Sequence (657 bp)
>Sequence
cgttatcaactgccatatacaaatcgggaactgttccacatgatgcaagtgtgccaggagttgttcataacttttgttcc
gtcaattgatactcaatcaaattatctggagggcgatcaagcaagaattatcatcgaccaatttttagatgactttccat
tatgcaaagtagttcattttggaccaaatcttgccagtcttttgattgcagataggaaacttttgacatcgattcaacgc
cgtattccacgtatttatctctccacacatgttgatgaaaagaatgggcctcttctctctacacttcctccattcgttac
gttgtgtgtagaaggaacttggccatttgaagtagaaagatatgtttcacctcgggtttctgttgtaattaagttctcga
ctggtgacgacggatatttgtgtgcttcacctgaatcagttgccaagaaagcacttttggcagcaaaactgagtgatcgc
cagactgttcttggatcgatggtttgcgacttatccactggatgtgaagctatgcctccttccctttcatacatgtccct
tcttgcatctgttggtgttgcgtataatagctcaactgatatgaagaaatatgcatttttgcttcctgttatcgcagcac
atcacatgctccttgac
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: