Sequence:
download
yk1626d09.5Sequence.fasta
>Sequence gttttaacccagttaaccaagatggatcagaagggttcacaaagagcactactggcacaaacaataaatgaaattgtcaa gcttcttattgaagctcacaatcaaaaaaaggatgtcaacttgaatcggctgaaatgcatcgttgctcaaaagaatggac tgagttttcaaccgaaactcgttgacattatcgctggagttccgtccgattacaaagacagccttcttccaaaactcaag gcaaaaccagttcgaactgcttctggaattgctgttgtagcagtgatgagcaaaccacatcgttgtcctcacatcaattt cactggaaacatttgtgtctattgtcccggtgggccagattctgatttcgagtattcaacacaaagttacaccggttatg agcctacaagtatgcgtgcaattcgtgctagatataacccttatttgcaaactcgtggaagactcaatcaattgatgcaa ctcggacactcagttgataaagttgaattcatcgtaatgggaggaacatttatgtcgctgcctgaagattatcgagactt tttcattcgaaatctacatgatgcactgagtggacatacatcagcgtcagttgaagaagcagtagcttattctgaaaggt ctaaaatgaaatgta
view Sequence (655 bp)
>Sequence
gttttaacccagttaaccaagatggatcagaagggttcacaaagagcactactggcacaaacaataaatgaaattgtcaa
gcttcttattgaagctcacaatcaaaaaaaggatgtcaacttgaatcggctgaaatgcatcgttgctcaaaagaatggac
tgagttttcaaccgaaactcgttgacattatcgctggagttccgtccgattacaaagacagccttcttccaaaactcaag
gcaaaaccagttcgaactgcttctggaattgctgttgtagcagtgatgagcaaaccacatcgttgtcctcacatcaattt
cactggaaacatttgtgtctattgtcccggtgggccagattctgatttcgagtattcaacacaaagttacaccggttatg
agcctacaagtatgcgtgcaattcgtgctagatataacccttatttgcaaactcgtggaagactcaatcaattgatgcaa
ctcggacactcagttgataaagttgaattcatcgtaatgggaggaacatttatgtcgctgcctgaagattatcgagactt
tttcattcgaaatctacatgatgcactgagtggacatacatcagcgtcagttgaagaagcagtagcttattctgaaaggt
ctaaaatgaaatgta
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: