Sequence:
download
yk1610f03.3Sequence.fasta
>Sequence gttgtttttttaattattcttatgacccgtcgagtctattgaaatataaccttaatttactgaaacccttgaacaaatat ttataatcctagtgcagtcttaacaagtttagttgcttcaattgctgttccccaacccaacgtgaatccgttgctcccgt gaccatagtgatgcacaaccatataatcttttgagtttccaacagatgtcctcttctgcgcttcaattctgacatgctta cgtcccgggcgaagtgctgaccattctttgataatctttggctcctaaatcataaatcaactttttcaatcaacttaaat ttaaaaaaaactaat
view Sequence (335 bp)
>Sequence
gttgtttttttaattattcttatgacccgtcgagtctattgaaatataaccttaatttactgaaacccttgaacaaatat
ttataatcctagtgcagtcttaacaagtttagttgcttcaattgctgttccccaacccaacgtgaatccgttgctcccgt
gaccatagtgatgcacaaccatataatcttttgagtttccaacagatgtcctcttctgcgcttcaattctgacatgctta
cgtcccgggcgaagtgctgaccattctttgataatctttggctcctaaatcataaatcaactttttcaatcaacttaaat
ttaaaaaaaactaat
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: