Sequence:
download
yk1541b09.5Sequence.fasta
>Sequence tttaattacccaagtttgagatctgcaaccatgccgccgaagcaacaagggcctagtaaaaagtccgagcaaaagcgcaa ggagaaagttatcgaggacaagacgttcggattgaaaaacaagaaaggaaataaaaaccagaagtttgtggcacaagttg aaaatcaagtccgtaacaacaatactcgtatggatcttgtccgacaacaagaagcagctaaaaaaaaagaaaaagacgag cttctcgatattgccaatcttttgaaacctgtggaacaaaaagtcgcaaaagatgtcgatccaaaatctcttctctgtgt attcttcaaacaaggtctttgcggaaaaggagcaaagtgcaaattcagtcacgatttggcagttgctcagaagacagcga agaagaacctgtatgcagacagcagagaagtcgaaaaagacgaagaaacnaacgagaactgggactcggacaaattgaat gaagtg
view Sequence (486 bp)
>Sequence
tttaattacccaagtttgagatctgcaaccatgccgccgaagcaacaagggcctagtaaaaagtccgagcaaaagcgcaa
ggagaaagttatcgaggacaagacgttcggattgaaaaacaagaaaggaaataaaaaccagaagtttgtggcacaagttg
aaaatcaagtccgtaacaacaatactcgtatggatcttgtccgacaacaagaagcagctaaaaaaaaagaaaaagacgag
cttctcgatattgccaatcttttgaaacctgtggaacaaaaagtcgcaaaagatgtcgatccaaaatctcttctctgtgt
attcttcaaacaaggtctttgcggaaaaggagcaaagtgcaaattcagtcacgatttggcagttgctcagaagacagcga
agaagaacctgtatgcagacagcagagaagtcgaaaaagacgaagaaacnaacgagaactgggactcggacaaattgaat
gaagtg
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: