Sequence:
download
yk1541b09.3Sequence.fasta
>Sequence aaaatggagaaaacttcaaataatagtcccttgtaatttgaaaaaaataatcaaatacagagaaaattgggactaccggt tagtcgtgacaaacaagaaataataatagatagcaggggaatcgggaaaaaagaaacactgaaattcaaagcaaaaacag aaaaagaacaggaaaaaagggggagcaccagaagtatactcttcaatcctcatcagaatcgaggttttcaacgtcttcgt caatgtcgaacaagtcctcgttgatgtccatctttgccattcctttagcagtagattcaacagcagtcgaggatttgctc atttgatccgtcagttcatcgtccattccgtcgaatttgaagaagttggcatcgatttcaaataccttttcattctcatc aacttcttccttctccatctcaatatctccggcctcgtcgtcgtcgttgttgaccagattggcgtcatataagaaaagat cacgtccagacattccattatgttttccagatttgatcttctctttcttttctttcaaatcggcttcttctttctctttt cgctctcttaacttcttcttcttccaggcaatgaaggtttggagtgttaattttgtgagatttttcgaactcaaagcggc tctctctttctcaacaagttcctcaatactaatttcatcttctttttgttgctccattgctttccgttcctttttcaaac atatccttctggtagacaatgccgatattgacatttttctcctccattcggac
view Sequence (773 bp)
>Sequence
aaaatggagaaaacttcaaataatagtcccttgtaatttgaaaaaaataatcaaatacagagaaaattgggactaccggt
tagtcgtgacaaacaagaaataataatagatagcaggggaatcgggaaaaaagaaacactgaaattcaaagcaaaaacag
aaaaagaacaggaaaaaagggggagcaccagaagtatactcttcaatcctcatcagaatcgaggttttcaacgtcttcgt
caatgtcgaacaagtcctcgttgatgtccatctttgccattcctttagcagtagattcaacagcagtcgaggatttgctc
atttgatccgtcagttcatcgtccattccgtcgaatttgaagaagttggcatcgatttcaaataccttttcattctcatc
aacttcttccttctccatctcaatatctccggcctcgtcgtcgtcgttgttgaccagattggcgtcatataagaaaagat
cacgtccagacattccattatgttttccagatttgatcttctctttcttttctttcaaatcggcttcttctttctctttt
cgctctcttaacttcttcttcttccaggcaatgaaggtttggagtgttaattttgtgagatttttcgaactcaaagcggc
tctctctttctcaacaagttcctcaatactaatttcatcttctttttgttgctccattgctttccgttcctttttcaaac
atatccttctggtagacaatgccgatattgacatttttctcctccattcggac
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: