Sequence:
download
yk1537f05.5Sequence.fasta
>Sequence actttgttcattttgaaggctcagtcacaccatttgaattcaacaaataaaaatgtcacaagtggccgcaatggaccttc gtgtacttacacagttcgacatcgccagtttggaagaggaccgcaaaaagatgttgtacgaggagccgatctctttggaa gaagccgctctgaacgccaacgacgtgatggtggcgccgagtcgaaagtcgtatgtgcacggctgttcgactgttccttt gctttttgaaactgttggagatcgacttcgatcagcagttgaccaggttccagataaggaatttttgattttcaaaagag aaggaatcaggaaaacttattcgcaagtcgccacagatgcagaaaacctggcttgcgggctcctccacttgggtttgaaa aaaggagatcgtattggaatttgggggccaaacacatacgagtggaccacaacacagtttgccagtgctcttgccggaat ggttctagtcaacataaacccatcatatcaatcagaagaacttcgctatgctattgaaaaagtaggaatcagagccctta tcacaccacctggattca
view Sequence (578 bp)
>Sequence
actttgttcattttgaaggctcagtcacaccatttgaattcaacaaataaaaatgtcacaagtggccgcaatggaccttc
gtgtacttacacagttcgacatcgccagtttggaagaggaccgcaaaaagatgttgtacgaggagccgatctctttggaa
gaagccgctctgaacgccaacgacgtgatggtggcgccgagtcgaaagtcgtatgtgcacggctgttcgactgttccttt
gctttttgaaactgttggagatcgacttcgatcagcagttgaccaggttccagataaggaatttttgattttcaaaagag
aaggaatcaggaaaacttattcgcaagtcgccacagatgcagaaaacctggcttgcgggctcctccacttgggtttgaaa
aaaggagatcgtattggaatttgggggccaaacacatacgagtggaccacaacacagtttgccagtgctcttgccggaat
ggttctagtcaacataaacccatcatatcaatcagaagaacttcgctatgctattgaaaaagtaggaatcagagccctta
tcacaccacctggattca
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: