Sequence:
download
yk1537f05.3Sequence.fasta
>Sequence ttatcttacgcaaaagcgaaagcgttgagagaaggagtaaagcgtcacaatttcaaaatatataaatgagggagacaaaa aaatttgcatataagtagttgaaagagttgaaattatattcaaagttggcaatggttgtgaagaggaactaaggcactat gctaactgatgccatgtggcgtcatataatggaacatgaacaggaaaactcgttagtcactctgctggaaatattgagag aagagaagacaaaagtgtcgggctggcgacgacgggaaacgtaaagagaaaagaatttgaaaattttgtagagggcagga ataagtgacgacgataaatcgaaatatacacgcaattggaatgtgtcaggcgagaaaagcggcgagctcccgacgacggg gaggacacttaaagctcggagaaatgagagacgacttgctggagacccagttcaatctttgacatttcgcggatttcaaa ctttttcacttttccagtcactgtcagcgggaattcgtactcctttttgaagaggatgtagcgaggaattttgaaatgag caatttttcccttgcaccaagccttaatatcctcttcagtcgtttttccttcagcgctttcgtgcaatctgacccaggcg cagaccacctcaccgaatcgttcatctggtactccgacaatatgaacatcttctactgactgatgcttgaataaaaattg ctctacttc
view Sequence (729 bp)
>Sequence
ttatcttacgcaaaagcgaaagcgttgagagaaggagtaaagcgtcacaatttcaaaatatataaatgagggagacaaaa
aaatttgcatataagtagttgaaagagttgaaattatattcaaagttggcaatggttgtgaagaggaactaaggcactat
gctaactgatgccatgtggcgtcatataatggaacatgaacaggaaaactcgttagtcactctgctggaaatattgagag
aagagaagacaaaagtgtcgggctggcgacgacgggaaacgtaaagagaaaagaatttgaaaattttgtagagggcagga
ataagtgacgacgataaatcgaaatatacacgcaattggaatgtgtcaggcgagaaaagcggcgagctcccgacgacggg
gaggacacttaaagctcggagaaatgagagacgacttgctggagacccagttcaatctttgacatttcgcggatttcaaa
ctttttcacttttccagtcactgtcagcgggaattcgtactcctttttgaagaggatgtagcgaggaattttgaaatgag
caatttttcccttgcaccaagccttaatatcctcttcagtcgtttttccttcagcgctttcgtgcaatctgacccaggcg
cagaccacctcaccgaatcgttcatctggtactccgacaatatgaacatcttctactgactgatgcttgaataaaaattg
ctctacttc
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: