Sequence:
download
yk147a7.3Sequence.fasta
>Sequence tctctttgttatttcctaaacaaccggggtaatttttacacgaatttttaaaaatttttttaanttttttacagcacaca ttttcagcagcagcttttgctctttttagccatcattggagctccaactctcgaccatttatcatatccggcggcttcat taaaccattttgcagtttcgacaactttgtccaaattga
view Sequence (199 bp)
>Sequence
tctctttgttatttcctaaacaaccggggtaatttttacacgaatttttaaaaatttttttaanttttttacagcacaca
ttttcagcagcagcttttgctctttttagccatcattggagctccaactctcgaccatttatcatatccggcggcttcat
taaaccattttgcagtttcgacaactttgtccaaattga
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: