Sequence:
download
yk1456d02.3Sequence.fasta
>Sequence attattttcattcattaaggtggatacagaaaaaaatattgatattaggaggtgcaagtacaagtgaatgtgaggatctg aaaagtgaaaacgaggaaaaatacttaataaggaaggttaaaatggtaaagcagaagccgaattattggcatatcgagtg aaatcatttccgtaactaaggcaaacatgcatcagagcttcggtatcttgttgagcgtagtgagcagtatattttccacc aacgagatcttcgtacagaactggcaagctgaacttgttgttggtatgcttgtatgtccaactcccagctccagttctca caaatccatctcttcgaattcgttttttgagggaagccgaaaatttctcccaatccagaatattcgcaggatgatccgtt tcctttggttcatcattttgaactatttcttcgacggaatcatctattacgacacgctccgattcgtcaacttcttcgat ttttactttcggaaacttgatatatttgcagaccgttgcaagttctttgactatcgtatcctcgatttctctcgccatcc aataactgtcaataaagtagatatcctgaggaattccaaactcttcgagcacttcgtttcgctgcagctctccgtagatg acgcgtagatcatatttgatagcgttatgggcaacttttcctccagccaatcggaatctttcataagaattccattctgt ttcactcatcatcgttggattaatctgcct
view Sequence (750 bp)
>Sequence
attattttcattcattaaggtggatacagaaaaaaatattgatattaggaggtgcaagtacaagtgaatgtgaggatctg
aaaagtgaaaacgaggaaaaatacttaataaggaaggttaaaatggtaaagcagaagccgaattattggcatatcgagtg
aaatcatttccgtaactaaggcaaacatgcatcagagcttcggtatcttgttgagcgtagtgagcagtatattttccacc
aacgagatcttcgtacagaactggcaagctgaacttgttgttggtatgcttgtatgtccaactcccagctccagttctca
caaatccatctcttcgaattcgttttttgagggaagccgaaaatttctcccaatccagaatattcgcaggatgatccgtt
tcctttggttcatcattttgaactatttcttcgacggaatcatctattacgacacgctccgattcgtcaacttcttcgat
ttttactttcggaaacttgatatatttgcagaccgttgcaagttctttgactatcgtatcctcgatttctctcgccatcc
aataactgtcaataaagtagatatcctgaggaattccaaactcttcgagcacttcgtttcgctgcagctctccgtagatg
acgcgtagatcatatttgatagcgttatgggcaacttttcctccagccaatcggaatctttcataagaattccattctgt
ttcactcatcatcgttggattaatctgcct
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: