Sequence:
download
yk1452b09.5Sequence.fasta
>Sequence attaccaaattcgactcctctcgatttccggaatcgatttcgaaaattcgacgaattttgtgccaaagtcacagcgctct gacggatcacacaatgaagaaatcagtgattcttctgctcctcgccttctcaacatggtgctcagctgaaaatactacgg acacaccatcaactgccgacccgactgccggcagtaccgacacctcagcgactcccatgccgactgatgcgccaactgcc gctccagctaacccgccaccgccaccggcagcccagcaaaaaaaattaaagcagtacgacttttcgggtccactgaccga gttgcaaggatcctacttgctaaagtccagagatcagtctcaagctcgtccatcgtgggcttccgtttggtccgttacag aaaccgaaagaaattttggaatctacttttggccgccgaattattgtcacgcagtctacctttgccttgttcctgcgaag ctgtacgacggag
view Sequence (493 bp)
>Sequence
attaccaaattcgactcctctcgatttccggaatcgatttcgaaaattcgacgaattttgtgccaaagtcacagcgctct
gacggatcacacaatgaagaaatcagtgattcttctgctcctcgccttctcaacatggtgctcagctgaaaatactacgg
acacaccatcaactgccgacccgactgccggcagtaccgacacctcagcgactcccatgccgactgatgcgccaactgcc
gctccagctaacccgccaccgccaccggcagcccagcaaaaaaaattaaagcagtacgacttttcgggtccactgaccga
gttgcaaggatcctacttgctaaagtccagagatcagtctcaagctcgtccatcgtgggcttccgtttggtccgttacag
aaaccgaaagaaattttggaatctacttttggccgccgaattattgtcacgcagtctacctttgccttgttcctgcgaag
ctgtacgacggag
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: