Sequence:
download
yk1447d06.5Sequence.fasta
>Sequence ggtttaattacccaagtttgagatactctctttccactgggttacacgtcacgacatatggcaagatgaattatctgttg actgctctgattgctcttttggctccgatttctgttgcatacaatgtcccacatggttttctcacaggtgaagccgtaac ttcccactccggcccaaacgatttggacggtgaacttcccgccactgatgaggtgaaacgggaaaagcgtggctatttct tcccgtcacatttccaaagtgacagtggtcttctttcaagatccgaacatccgaatgaatatctcaaaaaatggattact cacgagcataatcggtataggcgtatggtgcctgcctccgacatgaacatgctctactggtccgatgagctggccgcttc agctcaacgccacgcggacacctgtgatttccgtcactcccgtggacgcatcaacgtcggcgaa
view Sequence (464 bp)
>Sequence
ggtttaattacccaagtttgagatactctctttccactgggttacacgtcacgacatatggcaagatgaattatctgttg
actgctctgattgctcttttggctccgatttctgttgcatacaatgtcccacatggttttctcacaggtgaagccgtaac
ttcccactccggcccaaacgatttggacggtgaacttcccgccactgatgaggtgaaacgggaaaagcgtggctatttct
tcccgtcacatttccaaagtgacagtggtcttctttcaagatccgaacatccgaatgaatatctcaaaaaatggattact
cacgagcataatcggtataggcgtatggtgcctgcctccgacatgaacatgctctactggtccgatgagctggccgcttc
agctcaacgccacgcggacacctgtgatttccgtcactcccgtggacgcatcaacgtcggcgaa
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: