Sequence:
download
yk1349b08.3Sequence.fasta
>Sequence tgattctatgaaattttggtgaaaatntgaaaaaaaaagtgagaagcttacacgtgtgatcataccacgcggggatcggg gatggaggggaaaagatatggaaatttctagtgaaaataatatctaaatgggcacaaaattgagttacagggagcaaatg tgtggaggaaggcacttttgagaagaggaattttttttgggaaaaacatttgaaacaaaaaaaactgaaaaatataggaa aatcatgtacaaaatatgaaaaaaaaaacgtntcacanag
view Sequence (280 bp)
>Sequence
tgattctatgaaattttggtgaaaatntgaaaaaaaaagtgagaagcttacacgtgtgatcataccacgcggggatcggg
gatggaggggaaaagatatggaaatttctagtgaaaataatatctaaatgggcacaaaattgagttacagggagcaaatg
tgtggaggaaggcacttttgagaagaggaattttttttgggaaaaacatttgaaacaaaaaaaactgaaaaatataggaa
aatcatgtacaaaatatgaaaaaaaaaacgtntcacanag
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: