Sequence:
download
yk1335d05.5Sequence.fasta
>Sequence ataacaaatcctgatggatcgacagacaacaagagtgaaaagtagtaaatcttatagctctcacttctcccgccaagaga cttatgtaaatggtgtaaaaaagatgtcaaaaagcaagtttcgtgcatttgttgagtacaagggcccggatggtggattc caagtgaaattatcagatggagatgaatttgaattatcagaagatgaacaagaggatgatgatacaagcctaagtcaatc atgttattctgaaattgattcggaatctgatattactggtccatcaccaaaaactgatttggataanagatatcaaaaag cttggtatgcggcaaaagagctggtggatagtgagcagagatatgtggacaagttgaaacttcttggtgatactttccga aatcggtt
view Sequence (408 bp)
>Sequence
ataacaaatcctgatggatcgacagacaacaagagtgaaaagtagtaaatcttatagctctcacttctcccgccaagaga
cttatgtaaatggtgtaaaaaagatgtcaaaaagcaagtttcgtgcatttgttgagtacaagggcccggatggtggattc
caagtgaaattatcagatggagatgaatttgaattatcagaagatgaacaagaggatgatgatacaagcctaagtcaatc
atgttattctgaaattgattcggaatctgatattactggtccatcaccaaaaactgatttggataanagatatcaaaaag
cttggtatgcggcaaaagagctggtggatagtgagcagagatatgtggacaagttgaaacttcttggtgatactttccga
aatcggtt
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: