Sequence:
download
yk1312g09.5Sequence.fasta
>Sequence gtttaattacccaagcttgagaatgaaattccttctcgcagtttttctgctagccgtatgtagcctcggagagtcgaaaa aaccaaaggcacagaaggttatctacgtgcagaaggtggtgccgccccagaagcagctctccgaatacgacctctgcaag gagcaatgccgaatcgaaagcgagacgcaatccaacaaagaacgcgtcgagcttttgaaacaggagatcgaccgagctga gcagttgctcgccgagcacaataaacacgtggatgctccggaaatcgcacccgaaacgtacatggaagctggtcaggttc cgccaatgcgtaaggctagccgttacgatcatttgaaaatggcagccaacaaaattgtcgagtcgacgagtgagctgaaa aatgcggtgacaggtggaggggataattgaattgtttttgaattgtaattgtgtaaattttcgaattttataaataaaaa tctgggtaaaaaaaaaa
view Sequence (497 bp)
>Sequence
gtttaattacccaagcttgagaatgaaattccttctcgcagtttttctgctagccgtatgtagcctcggagagtcgaaaa
aaccaaaggcacagaaggttatctacgtgcagaaggtggtgccgccccagaagcagctctccgaatacgacctctgcaag
gagcaatgccgaatcgaaagcgagacgcaatccaacaaagaacgcgtcgagcttttgaaacaggagatcgaccgagctga
gcagttgctcgccgagcacaataaacacgtggatgctccggaaatcgcacccgaaacgtacatggaagctggtcaggttc
cgccaatgcgtaaggctagccgttacgatcatttgaaaatggcagccaacaaaattgtcgagtcgacgagtgagctgaaa
aatgcggtgacaggtggaggggataattgaattgtttttgaattgtaattgtgtaaattttcgaattttataaataaaaa
tctgggtaaaaaaaaaa
Strand:
(+)
Predicted Genes & Transcriptional Units:
Transcripts in this region: